SGN Marker solcap_snp_sl_34900

SGN-M22375

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72354)
Chromosome
8
Position
67.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64886)
Chromosome
8
Position
94.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58706)
Chromosome
8
Position
61.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCAACCTAGATTTCTGGGACATTTCTTTAGTCGATGGATTTAATATTCC
  
3' flanking region
ATGACTTTCGCCCCGACCAATCCTAGTGGAGGGAAATGCCATGCAATTCA
SNP nucleotide
AG
SNPdb format
AGCAACCTAGATTTCTGGGACATTTCTTTAGTCGATGGATTTAATATTCC[A/G]
ATGACTTTCGCCCCGACCAATCCTAGTGGAGGGAAATGCCATGCAATTCA
  
Genomic location of solcap_snp_sl_34900  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22375 marker 22375
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)