Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T1744

SGN-M2239
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZBJ79TH
Arabidopsis best BAC match: AC002505.2
Arabidopsis position: 2.1490000
Arabidopsis identities: 0.637
Best GenBank protein hit: AAF98368.1
Evalue: 5.5e-38
Identities: 0.684
Description: patatin-like protein 1 [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49489)
Chromosome
2
Position
46.76 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47423)
Chromosome
2
Position
130.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39767)
Chromosome
2
Position
117.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1744 was used as an overgo probe on plate 11 [well B5]

Plausible BAC Matches:   P208N01

 Overgo Sequences

A sequence
ACAGCCATGTTAGCTGCACCAAAC
B sequence
GAGGGCGTTTAGCTTTGTTTGGTG
AB sequence
ACAGCCATGTTAGCTGCACCAAACAAAGCT
Marker sequence
GGTGAGATGAACTAATTGTTAAGTCTCTATACATAGGAGTGTTATTTTTA
CGTGAACTTATCTTTTGGATATTCCGATGGAAAACTCAGCTGCAGTTGGA
GTAGCAATGCCGCCTCCTAACAAAGGGAAGCTAATAACCATTCTCTCCAT
CGATGGAGGAGGAATTAGAGGAATCATTCCCGGGGTTATCCTTGCATATC
TTGAATCACAACTTCAGGAATTGGATGGTGAAGATGCAAGAATCGCGGAT
TATTTTGACTTGATAGCAGGAACAAGCACGGGCGGCCTTGTAACAGCCAT
GTTAGCTGCACCAAACAAAGCTAAACGCCCTCTTTATGCTGCCAAAGATA
TTACTCCTTTCTATCTTGAGCACTCCCCCAAAATCTTTCATCAGATTGGT
GGACCATTTGGTGGGGCAATAAATCTAACAAAAATGTTGAACAGACCAAA
ATATGATGGGAAGTATCTTCACACACTTATAAAGGGACTCCTANGAGGTA
CCAAGTTGCATGATACCTTAACTGCCGGCGTAATCCCAACTTTTGACATC
AAGGAACTTTAGCCTGTCAT
Genomic location of T1744  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2239 marker 2239
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)