SGN Marker solcap_snp_sl_35068

SGN-M22391

Synonyms  
CL017423-0090
CL017423-0090_solcap_snp_sl_35068
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58722)
Chromosome
6
Position
2.61 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCTCCTGTCTAGCTTTAAATAGTTCAGCACTTTGAATAGCAGCTCTCCA
  
3' flanking region
GAATGGGAAACAAGCTCTAACTTTGGATGAAGGTAGAATGGAACCCGTGC
SNP nucleotide
CG
SNPdb format
ACCTCCTGTCTAGCTTTAAATAGTTCAGCACTTTGAATAGCAGCTCTCCA[C/G]
GAATGGGAAACAAGCTCTAACTTTGGATGAAGGTAGAATGGAACCCGTGC
  
Genomic location of solcap_snp_sl_35068  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22391 marker 22391
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)