SGN Marker solcap_snp_sl_35094

SGN-M22393

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72360)
Chromosome
6
Position
6.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68516)
Chromosome
6
Position
5.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64891)
Chromosome
6
Position
8.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58724)
Chromosome
6
Position
2.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAGTATATTTATGTGCAGAACATTTGCAGCCAATGGCAGAAAGGTATAG
  
3' flanking region
TCACAGAAGCATGCAACACATTCCTGTTTGGTGGTGGCACAAAAGTCATC
SNP nucleotide
AG
SNPdb format
CAAGTATATTTATGTGCAGAACATTTGCAGCCAATGGCAGAAAGGTATAG[A/G]
TCACAGAAGCATGCAACACATTCCTGTTTGGTGGTGGCACAAAAGTCATC
  
Genomic location of solcap_snp_sl_35094  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22393 marker 22393
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)