SGN Marker T1746

SGN-M2240
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TRZBJ90TH
Arabidopsis best BAC match: AB010692.1
Arabidopsis position: 5.0070000
Arabidopsis identities: 0.782
Best GenBank protein hit: BAA82306.1
Evalue: 1.0e-69
Identities: 0.941
Description: peroxidase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49490)
Chromosome
5
Position
61.71 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47424)
Chromosome
5
Position
97.22 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39768)
Chromosome
5
Position
84.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1746 was used as an overgo probe on plate 11 [well C12]

Plausible BAC Matches:   P138J03,   P215C05,   P123E06,   P228A01,   P246A15,   P207D06,   P227B07

 Overgo Sequences

A sequence
CGGATGTGATGGATCACTACTCCT
B sequence
GCTTGATGTGTCATCAAGGAGTAG
AB sequence
CGGATGTGATGGATCACTACTCCTTGATGA
Marker sequence
GTAATGGCTTCTTCAAAAAATAACACTATGGTTTTTTTATTTTTGCTTGT
GACCTTATTAATTGGAAGTTCATCAGCACAGCTTTCTACTAATTTTTACT
CAAAATCATGTCCTAAACTTTATCAAACAATAAAATCAACAGTTCAATCA
GCTATCAACAAGGAAACTCGAATGGGCGCTTCGCTTCTTAGGCTTTTCTT
TCATGATTGCTTTGTTAACGGATGTGATGGATCACTACTCCTTGATGACA
CATCAAGCTTTACTGGAGAAAAAAGGGCTGCTCCAAATGTGAATTCTGTA
AGAGGATTTGAAGTCATTGACAACATCAAATCTGCTGTAGAAAAAGCATG
CCCCGGCATTGTTTCTTGTGCTGATATTTTGGCTGTCACTGCTCGGGACT
CTGATGTTATTCTTGGAGGGCCTAATTGGAATGTAAAATTGGGCAGAAGA
GATGCCAGAACAGCAAGCCAAGG
Genomic location of T1746  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2240 marker 2240
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)