Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_35177

SGN-M22404

Synonyms  
Le004723_17
Le004723_17_solcap_snp_sl_35177
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58735)
Chromosome
6
Position
2.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATTAGTATGGCCGACGATGAAGCAGAGATGTACGACGGAGCTAGGGCAC
  
3' flanking region
GTTCCCGTTGTCGTTTGGTAAGCAAGCTAAATCTCAAAAATCTCTCGAAC
SNP nucleotide
AG
SNPdb format
TATTAGTATGGCCGACGATGAAGCAGAGATGTACGACGGAGCTAGGGCAC[A/G]
GTTCCCGTTGTCGTTTGGTAAGCAAGCTAAATCTCAAAAATCTCTCGAAC
  
Genomic location of solcap_snp_sl_35177  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22404 marker 22404
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)