SGN Marker solcap_snp_sl_35220

SGN-M22412

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72368)
Chromosome
6
Position
3.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68526)
Chromosome
6
Position
0.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58743)
Chromosome
6
Position
1.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCTTATCTCTTCCCATTTTCGTACTCATTGCTCGTCTCTTCAAGTGTCG
  
3' flanking region
CATTCAGTTGCAGCTCCACCGATGGTGAAAATCATGAAAATGGGTGTGTT
SNP nucleotide
CG
SNPdb format
CTCTTATCTCTTCCCATTTTCGTACTCATTGCTCGTCTCTTCAAGTGTCG[C/G]
CATTCAGTTGCAGCTCCACCGATGGTGAAAATCATGAAAATGGGTGTGTT
  
Genomic location of solcap_snp_sl_35220  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22412 marker 22412
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)