SGN Marker T1749

SGN-M2242
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBK20TH
Arabidopsis best BAC match: AL050351.1
Arabidopsis position: 4.1960000
Arabidopsis identities: 0.717
Best GenBank protein hit: CAB80575.1
Evalue: 2.0e-43
Identities: 0.761
Description: Inositol monophosphatase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39769)
Chromosome
1
Position
161.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1749 was used as an overgo probe on plate 7 [well H11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTAGTAGAGTCTGGTCTTAAGCCG
B sequence
GTGAGAGGAAGTCGTACGGCTTAA
AB sequence
GTAGTAGAGTCTGGTCTTAAGCCGTACGAC
Marker sequence
GATTTGTTCGAAGGGGATGCTGAGATTGCCTTTGCTCGTGTTAGAAGCAA
GGTGAAAGTTCCACTGTACGGATGTGACTGCTATGCTTATGCCCTATTGG
CTTCTGGATTTGTGGATCTTGTAGTAGAGTCTGGTCTTAAGCCGTACGAC
TTCCTCTCACTTGTACCAGTAATAGAAGGTGCTGGAGGAACAATAACCGA
CTGGAAAGGCCAACATTTTAATTGGAAAGCTTCTGCTGGTTCACCAGCCA
CAAGTTTTAATGTAGTGGCAGCCGGTGATAAAGAAGTTCACCAAGAAGCT
CTGGATGCATTGCAGTGGCGGTAGAGGCTGCTATGTTTCACTGTATTGGC
TCACAACTCCCTTTGGCGAATATCATAGTTATTGATTACTTTGCCGCTGA
GTCTCTACATTAATTTTAACTTTTGAATCAAATTATGGTGGTCCTCTGTT
GATAGTTATTT
Genomic location of T1749  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2242 marker 2242
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)