SGN Marker solcap_snp_sl_35846

SGN-M22496

Synonyms  
SGN-U581789_snp1077
SGN-U581789_snp1077_solcap_snp_sl_35846
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70468)
Chromosome
2
Position
30.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63472)
Chromosome
2
Position
59.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58827)
Chromosome
2
Position
35.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGATTGCATCTGCTGTTGAATCGGTGGTGGAGGAGAAAGGGGAAGAAAAT
  
3' flanking region
TGTGTGTTGTTGATGAGAAAGATACAGCTTCAGATACTGTTGTGGAAAAT
SNP nucleotide
TC
SNPdb format
TGATTGCATCTGCTGTTGAATCGGTGGTGGAGGAGAAAGGGGAAGAAAAT[T/C]
TGTGTGTTGTTGATGAGAAAGATACAGCTTCAGATACTGTTGTGGAAAAT
  
Genomic location of solcap_snp_sl_35846  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22496 marker 22496
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)