SGN Marker solcap_snp_sl_35956

SGN-M22504

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72432)
Chromosome
2
Position
29.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68568)
Chromosome
2
Position
41.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58835)
Chromosome
2
Position
34.97 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTAATTCAGCTCAGTTTAGGTAGAGCAATCTTCTGGAGTAGTACAGGGG
  
3' flanking region
TTAATGTGATACACATTGTCTGTTTCATCTCCGTGTGGGAAACTTGCTGG
SNP nucleotide
AG
SNPdb format
CTTAATTCAGCTCAGTTTAGGTAGAGCAATCTTCTGGAGTAGTACAGGGG[A/G]
TTAATGTGATACACATTGTCTGTTTCATCTCCGTGTGGGAAACTTGCTGG
  
Genomic location of solcap_snp_sl_35956  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22504 marker 22504
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)