SGN Marker solcap_snp_sl_35968

SGN-M22508

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64947)
Chromosome
2
Position
56.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58839)
Chromosome
2
Position
34.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTCTTTTTCGAGGCTCAATATCTAGAGATCAGGTAGCTGAAGTTGCAGT
  
3' flanking region
GAGGCATTGCTCCATCCAGAATCTCATTACAAAGTCGTGGAGATAGTGGC
SNP nucleotide
TC
SNPdb format
ACTCTTTTTCGAGGCTCAATATCTAGAGATCAGGTAGCTGAAGTTGCAGT[T/C]
GAGGCATTGCTCCATCCAGAATCTCATTACAAAGTCGTGGAGATAGTGGC
  
Genomic location of solcap_snp_sl_35968  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22508 marker 22508
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)