SGN Marker solcap_snp_sl_35973

SGN-M22509

Synonyms  
SL10649_1116_solcap_snp_sl_35973
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70533)
Chromosome
2
Position
29.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63511)
Chromosome
2
Position
55.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58840)
Chromosome
2
Position
34.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAACGTGAAGATTTCAAGATCATAGACTTGGAAAGTGATGAAAGAGCG
  
3' flanking region
CGGAATTCCAGAACACCAAATACATGCTTGCACATAACGTATTTCCTGTC
SNP nucleotide
TC
SNPdb format
AAAAACGTGAAGATTTCAAGATCATAGACTTGGAAAGTGATGAAAGAGCG[T/C]
CGGAATTCCAGAACACCAAATACATGCTTGCACATAACGTATTTCCTGTC
  

Map: Sun1642 x LA1589   
Map version
85 (location: 43746)
Chromosome
2
Position
6.40 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
CAAGCATGTATTTGGTGTTCTGGAATTCCG
ASPE primers (5'-3')
GGTGTTCTGGAATTCCGA
GGTGTTCTGGAATTCCGG
3' flanking region
CGCTCTTTCATCACTTTCCAAGTCTATGAT
SNP nucleotide
AG
SNPdb format
CAAGCATGTATTTGGTGTTCTGGAATTCCG[A/G]
CGCTCTTTCATCACTTTCCAAGTCTATGAT
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43183)
Chromosome
2
Position
45.20 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
CAAGCATGTATTTGGTGTTCTGGAATTCCG
ASPE primers (5'-3')
GGTGTTCTGGAATTCCGA
GGTGTTCTGGAATTCCGG
3' flanking region
CGCTCTTTCATCACTTTCCAAGTCTATGAT
SNP nucleotide
AG
SNPdb format
CAAGCATGTATTTGGTGTTCTGGAATTCCG[A/G]
CGCTCTTTCATCACTTTCCAAGTCTATGAT
  
Genomic location of solcap_snp_sl_35973  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22509 marker 22509
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)