SGN Marker T1759

SGN-M2251
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBL06TH
Arabidopsis best BAC match: AC009525.3
Arabidopsis position: 1.0030000
Arabidopsis identities: 0.723
Best GenBank protein hit: AAF02880.1
Evalue: 1.2e-31
Identities: 0.600
Description: Unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39774)
Chromosome
9
Position
60.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1759 was used as an overgo probe on plate 16 [well D2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTCTGCCGAAGAAGAACCCTAATG
B sequence
AACGCCGGTTTGAACACATTAGGG
AB sequence
GTCTGCCGAAGAAGAACCCTAATGTGTTCA
Marker sequence
GCATCGATAGGGTTTATCAAAGCACAATCCCCTTAAACCCTAGCCCCTCT
TTCACACAGAGATGGGTGGATCACGGCGGAAGTTCAAGAGATCAAGAACA
AAAGTGAGAGTGGGTCTGCCGAAGAAGAACCCTAATGTGTTCAAACCGGC
GTTTTCTCTTTCACCGAAGCTCCGGTCACTGGTCAACTCTCATTGGGATG
ATAAAGGCAGCGTAATCGATAATTACAAGTCATTCGGCGTCGTTTCGAAC
CCTAATTTGCTTGGTGTTCGTTGCCGGACCTCTCATATGATTGAAACTGA
CTCTCTTCAAGTTCCGCCGCCGAAGAAGCTGCCACCTACCTCTGAGGATG
ATGATGATGATGCCGATGCGTTTGAGGATTTGGATGATTCTGGCAGTGAC
GTTGAGGAAGACGATCTTAAGTCATCACTTGGGAAGAAACGAAAGGATGG
Genomic location of T1759  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2251 marker 2251
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)