SGN Marker solcap_snp_sl_36188

SGN-M22534

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72442)
Chromosome
2
Position
75.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68571)
Chromosome
2
Position
101.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64952)
Chromosome
2
Position
140.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58865)
Chromosome
2
Position
48.03 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCACATTCTTCCAGGGTAATAATAATAGGTATCATTTCCAGAACTCCTAC
  
3' flanking region
AGGATCTATTGCAGTTCTTAGACCAGGAAAAAAGACATGCCTTAGCTGCG
SNP nucleotide
AG
SNPdb format
CCACATTCTTCCAGGGTAATAATAATAGGTATCATTTCCAGAACTCCTAC[A/G]
AGGATCTATTGCAGTTCTTAGACCAGGAAAAAAGACATGCCTTAGCTGCG
  
Genomic location of solcap_snp_sl_36188  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22534 marker 22534
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)