SGN Marker solcap_snp_sl_36243

SGN-M22552

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58883)
Chromosome
2
Position
46.53 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACGATTTTGTTAGAGATATCGGGTCGGGTAACTTTGGCGTTGCGAGGTT
  
3' flanking region
ATGACAGATAAGCAGACTAAAGAGCTAGTTGCTGTCAAGTACATCGAAAG
SNP nucleotide
AG
SNPdb format
TACGATTTTGTTAGAGATATCGGGTCGGGTAACTTTGGCGTTGCGAGGTT[A/G]
ATGACAGATAAGCAGACTAAAGAGCTAGTTGCTGTCAAGTACATCGAAAG
  
Genomic location of solcap_snp_sl_36243  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22552 marker 22552
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)