SGN Marker solcap_snp_sl_36287

SGN-M22564

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68579)
Chromosome
2
Position
88.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64961)
Chromosome
2
Position
123.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58895)
Chromosome
2
Position
45.54 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAGATTCTGCTGTAAGGCTTTTGGTATCGCATTATCTTCTGTCGTTTCTA
  
3' flanking region
ATAAAACCGCCTAACACAACCATACTTGGAGTCGGATAGACAAAGCTTCT
SNP nucleotide
TC
SNPdb format
TAGATTCTGCTGTAAGGCTTTTGGTATCGCATTATCTTCTGTCGTTTCTA[T/C]
ATAAAACCGCCTAACACAACCATACTTGGAGTCGGATAGACAAAGCTTCT
  
Genomic location of solcap_snp_sl_36287  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22564 marker 22564
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)