SGN Marker T1768

SGN-M2258
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZBL94TH
Arabidopsis best BAC match: AC005679.1
Arabidopsis position: 1.1498000
Arabidopsis identities: 0.679
Best GenBank protein hit: AAC83040.1
Evalue: 2.0e-59
Identities: 0.731
Description: Similar to gb|X92762 tafazzins protein from Homo sapiens. [Arabidopsis thaliana]
Comment: responsible for Bath syndrome in homo sapiens
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49491)
Chromosome
2
Position
32.90 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47425)
Chromosome
2
Position
35.54 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39775)
Chromosome
2
Position
31.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1768 was used as an overgo probe on plate 10 [well E10]

Plausible BAC Matches:   P042C04,   P282E10,   P136A05

 Overgo Sequences

A sequence
GGAAAGTGGTGATCACGGCGATAG
B sequence
GCCTTAGCGAAAGTACCTATCGCC
AB sequence
GGAAAGTGGTGATCACGGCGATAGGTACTT
Marker sequence
GCTCGGAAAGTGGTGATCACGGCGATAGGTACTTTCGCTAAGGCGGTGGC
CAATCTATTGAACACCACCACCGTGCACAACGGCGACGTCCTTATCCGGC
TAGTTCGATCCCGCCCAGCCGGCGTTCCTCTCCTCACCGTCAGCAATCAC
ATGTCCACTTTAGATGACCCAGTTATGTGGGCATTCAAAGGTTTTCCAAT
TTGTGATGCAAAGCTGGCTCGATGGGTACTGGCAGCGGAAGACATATGCT
TTAAAAATACAGTATTGTCATACTTTTTCCGGATCGGGAAATGTATACCA
ATAACAAGAGGGGGTGGAATATATCAAGAACATATGAACGAAGCTCTTGA
TCGTTTGACTGAAGGAGCCTGGCTGCATACATTTCCAGAAAGGAAGGTCT
GTCAAGAAGATGCTCCTATAAGACGATTGAAGTGGGAACTGCCAGTCTCA
TTGCTCGTGCCCCCGTGACTCCAAT
Genomic location of T1768  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2258 marker 2258
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)