SGN Marker solcap_snp_sl_36384

SGN-M22587

Synonyms  
CL016047-0183
CL016047-0183_solcap_snp_sl_36384
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58918)
Chromosome
2
Position
31.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAATCACACCCTTTTTATCCACTCTCATGATTTCAACTATAGCCCAAATT
  
3' flanking region
GGAACCCGAACCCGGTTCCCTAGATTCAGATTCAGGTTCGGATCACTCGG
SNP nucleotide
CG
SNPdb format
TAATCACACCCTTTTTATCCACTCTCATGATTTCAACTATAGCCCAAATT[C/G]
GGAACCCGAACCCGGTTCCCTAGATTCAGATTCAGGTTCGGATCACTCGG
  
Genomic location of solcap_snp_sl_36384  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22587 marker 22587
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)