SGN Marker T1775

SGN-M2262
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBM68TH
Arabidopsis best BAC match: AC008017.2
Arabidopsis position: 1.1400000
Arabidopsis identities: 0.812
Best GenBank protein hit: AAD55656.1
Evalue: 1.8e-19
Identities: 0.816
Description: Hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39776)
Chromosome
6
Position
43.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1775 was used as an overgo probe on plate 1 [well B5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GATGTAGTCACCTTCCTTGACCCT
B sequence
GAATAAGCTCCATGGGAGGGTCAA
AB sequence
GATGTAGTCACCTTCCTTGACCCTCCCATG
Marker sequence
TGCAGTATCCTCAAGCAACAGCTGCACCAGAGAGGGCGCGCGCCCGTAGC
CTCGCGGTCTTCTCCCCAAAAATAATCACTTGCAAAAATCGGCAGCAAGC
TTCGCATTTCTGTTCCACAAAGTTTGGCTCAGCTCTTCCGTCCGGCACGT
CTCTGTCAATTTCGCGTCGGGCGAACTACAATGCCGCCGTACGGGCAACT
TCGTCTTCATTCTCCAGCTCTGCCTCACCGTGGGATGAAAAACCCTACCA
AGTTTTACCGAATGGCAAGATAGTGTACTTGGACGAACAGGATGTAGTCA
CCTTCCTTGACCCTCCCATGGAGCTTATTCCTTTGGATCCATCTTCTTAT
AATCCCGCCCTTTATCTCTGGAAG
Genomic location of T1775  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2262 marker 2262
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)