SGN Marker solcap_snp_sl_36725

SGN-M22628

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72486)
Chromosome
1
Position
109.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68602)
Chromosome
1
Position
99.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58959)
Chromosome
1
Position
85.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTAGATAGTAAATGAGAGGTTGAAAGAGTGAAAGACGAAGATGAACGCTT
  
3' flanking region
AATCGGGAAGTGAATTTAGGGTTTGAGAAGTTGAATTTGTGAGTGTTTAC
SNP nucleotide
TC
SNPdb format
CTAGATAGTAAATGAGAGGTTGAAAGAGTGAAAGACGAAGATGAACGCTT[T/C]
AATCGGGAAGTGAATTTAGGGTTTGAGAAGTTGAATTTGTGAGTGTTTAC
  
Genomic location of solcap_snp_sl_36725  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22628 marker 22628
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)