SGN Marker solcap_snp_sl_36856

SGN-M22640

Synonyms  
Le018066_70
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72496)
Chromosome
9
Position
57.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68608)
Chromosome
9
Position
70.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58971)
Chromosome
9
Position
65.17 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAAAAGAATGTGAAGGAAGCACTGACTACGGGGTAAATGACATGTCTTC
  
3' flanking region
GGTGCATCATCTATCTGCAGGAAAGCCGATTCCAACGACGGTGTTCAACT
SNP nucleotide
TC
SNPdb format
TCAAAAGAATGTGAAGGAAGCACTGACTACGGGGTAAATGACATGTCTTC[T/C]
GGTGCATCATCTATCTGCAGGAAAGCCGATTCCAACGACGGTGTTCAACT
  
Genomic location of solcap_snp_sl_36856  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22640 marker 22640
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)