SGN Marker solcap_snp_sl_36878

SGN-M22643

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72498)
Chromosome
9
Position
68.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68610)
Chromosome
9
Position
82.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58974)
Chromosome
9
Position
66.40 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTTTCACTTGAATTCTGTCCATTATATTGACCTTAGGGGCATCAAGGAT
  
3' flanking region
GTCTTAGGCATCGATAATGCCCATTGCATGCCCCAAATTGAGAGAGGCCT
SNP nucleotide
TC
SNPdb format
GGTTTCACTTGAATTCTGTCCATTATATTGACCTTAGGGGCATCAAGGAT[T/C]
GTCTTAGGCATCGATAATGCCCATTGCATGCCCCAAATTGAGAGAGGCCT
  
Genomic location of solcap_snp_sl_36878  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22643 marker 22643
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)