SGN Marker solcap_snp_sl_36963

SGN-M22650

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72503)
Chromosome
1
Position
61.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58981)
Chromosome
1
Position
70.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTCTAACTTTGACGATTTATTATTCCCAACACTCTGACCTGAACCATCC
  
3' flanking region
GGAAAAAGTTTATCTCAAAATCCCTTGATGGGGCTTCCCCTGCTCTATTG
SNP nucleotide
TG
SNPdb format
CCTCTAACTTTGACGATTTATTATTCCCAACACTCTGACCTGAACCATCC[T/G]
GGAAAAAGTTTATCTCAAAATCCCTTGATGGGGCTTCCCCTGCTCTATTG
  
Genomic location of solcap_snp_sl_36963  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22650 marker 22650
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)