SGN Marker solcap_snp_sl_36988

SGN-M22651

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64995)
Chromosome
8
Position
124.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58982)
Chromosome
8
Position
62.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGCCGTCAAAGGGAGACGCCGACGAGGCCGGAGCTACACCGGAGAATGC
  
3' flanking region
AGGAAATACAACTGTAATCTAATGAAGCTTATTGGTCAGAAGAAGGGTAC
SNP nucleotide
AT
SNPdb format
TGGCCGTCAAAGGGAGACGCCGACGAGGCCGGAGCTACACCGGAGAATGC[A/T]
AGGAAATACAACTGTAATCTAATGAAGCTTATTGGTCAGAAGAAGGGTAC
  
Genomic location of solcap_snp_sl_36988  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22651 marker 22651
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)