SGN Marker solcap_snp_sl_37108

SGN-M22673

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59004)
Chromosome
7
Position
61.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAGCATCAGAGAACTCTGCAGTCATTGACTCAGTATAGGTTCCCACAAC
  
3' flanking region
GGCGGTCTATTTCTATTAGCGTTCTTGACGAGTCCACCGGAGGTGCAATC
SNP nucleotide
CG
SNPdb format
GTAGCATCAGAGAACTCTGCAGTCATTGACTCAGTATAGGTTCCCACAAC[C/G]
GGCGGTCTATTTCTATTAGCGTTCTTGACGAGTCCACCGGAGGTGCAATC
  
Genomic location of solcap_snp_sl_37108  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22673 marker 22673
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)