SGN Marker solcap_snp_sl_37116

SGN-M22676

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68620)
Chromosome
5
Position
56.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65002)
Chromosome
5
Position
68.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59007)
Chromosome
5
Position
58.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTACTAACATCAGTTTCCCTAACTCTCAACACCCATTTCTCTAATACACC
  
3' flanking region
AAATACTTAACATAAACCAATTTCAAAGCCATCCCATAACTCGAATCGAA
SNP nucleotide
TC
SNPdb format
CTACTAACATCAGTTTCCCTAACTCTCAACACCCATTTCTCTAATACACC[T/C]
AAATACTTAACATAAACCAATTTCAAAGCCATCCCATAACTCGAATCGAA
  
Genomic location of solcap_snp_sl_37116  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22676 marker 22676
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)