SGN Marker T1785

SGN-M2270
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZBP48TH
Arabidopsis best BAC match: AC003974.2
Arabidopsis position: 2.1840000
Arabidopsis identities: 0.770
Best GenBank protein hit: CAA50575.1
Evalue: 5.8e-49
Identities: 0.841
Description: cytochrome b5 [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39780)
Chromosome
6
Position
100.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39781)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39782)
Chromosome
6
Position
5.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
C


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1785 was used as an overgo probe on plate 2 [well D2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P192O24,   P049I18,   P047P04,   P130P18,   P319D15,   P296C04,   P262M13,   P094J09,   P269M20,   P196I06,   P069I11,   P320A01,   P034C13,   P268F21,   P016A08,   P112N17,   P205O23,   P015F02,   P261G17

 Overgo Sequences

A sequence
TTTGAGGATGTCGGACACAGCAGT
B sequence
ACATTGCTCGAGCACTACTGCTGT
AB sequence
AAAGAGGGGTGAATGGGATAGGGTGTGGCT
Marker sequence
GGGGAAAGAGGGGTGAATGGGATAGGGTGTGGCTGATCTCTTCTTGTGTA
TGATGTGACAAAATTCTTGGAGGATCACCCACGTGGTGATGATGTTTTGT
TGTCTGCAACAGGGAAGGATGCAACTGATGATTTTGAGGATGTCGGACAC
AGCAGTAGTGCTCGAGCAATGTTGGACGAGTATTATGTAGGAGAAATCGA
TTCTTCAACCATCCCAACAAGTGTAAAGTACACTCCTCCAAAACAGCCTC
ATTACAACCAGGACAAAACAACAGAGTTCATCATTAAGATCCTCCAGTTC
TTGGTTCCTTTGATTATTTTAGGAGGTGCTGTTGGCCTCCGCTTCTACAC
CAAACAGTCAACTTCTTGAAGATTGAATAATCGGTGATGCTATAACAACA
AATGAAATCAACGAGACGTTACAAGAACAATTAGCTACCTTTTTCTCTGT
TCCCATTTTTAACTTTTTCATCTTGGTGTTATATATATCAATCTACGCCT
CGTGAACTTGCTTTATTTGGATCTTGTCACTT
Genomic location of T1785  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2270 marker 2270
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)