SGN Marker solcap_snp_sl_37209

SGN-M22702

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72524)
Chromosome
5
Position
59.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68627)
Chromosome
5
Position
64.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65009)
Chromosome
5
Position
90.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59033)
Chromosome
5
Position
61.18 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATTCAATTGGTCTTGTTTGTTTGGCCCAATAGGCCAATGTGGAGTGTTA
  
3' flanking region
TATAATTGGAGATTCGGGGTTTTTTCTTCTTCTTTTCAATTGTGGGGGAT
SNP nucleotide
AC
SNPdb format
AATTCAATTGGTCTTGTTTGTTTGGCCCAATAGGCCAATGTGGAGTGTTA[A/C]
TATAATTGGAGATTCGGGGTTTTTTCTTCTTCTTTTCAATTGTGGGGGAT
  
Genomic location of solcap_snp_sl_37209  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22702 marker 22702
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)