SGN Marker solcap_snp_sl_37267

SGN-M22711

Synonyms  
SGN-U576433_snp129584
SGN-U576433_snp129584_solcap_snp_sl_37267
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70430)
Chromosome
5
Position
62.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59042)
Chromosome
5
Position
61.61 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCATTGGCAGTAGCACCAGCAGATTCATCTTTTACAGATTCCCCATTCA
  
3' flanking region
TCCATTGCTGTTCTTACTTTTCAGTGTTTCTCTTACGATTATATTCTTCC
SNP nucleotide
TC
SNPdb format
TCCATTGGCAGTAGCACCAGCAGATTCATCTTTTACAGATTCCCCATTCA[T/C]
TCCATTGCTGTTCTTACTTTTCAGTGTTTCTCTTACGATTATATTCTTCC
  
Genomic location of solcap_snp_sl_37267  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22711 marker 22711
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)