Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker solcap_snp_sl_37524

SGN-M22733

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68635)
Chromosome
5
Position
80.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65018)
Chromosome
5
Position
128.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59064)
Chromosome
5
Position
63.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGTGAACTTCGATCTGCAACCAGAAATTTCCATCGTGACAGTGTAGTTG
  
3' flanking region
AGAAGGAGGTTTTGGTTCAGTTTTCAAAGGCTGGGTCGACGAACATACTC
SNP nucleotide
TG
SNPdb format
CAGTGAACTTCGATCTGCAACCAGAAATTTCCATCGTGACAGTGTAGTTG[T/G]
AGAAGGAGGTTTTGGTTCAGTTTTCAAAGGCTGGGTCGACGAACATACTC
  
Genomic location of solcap_snp_sl_37524  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22733 marker 22733
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)