SGN Marker T1789

SGN-M2274
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.07
Tomato EST read: TRZBP68TH
Arabidopsis best BAC match: AB026647.1
Arabidopsis position: 3.0780000
Arabidopsis identities: 0.852
Best GenBank protein hit: AAB82062.1
Evalue: 1.4e-78
Identities: 0.816
Description: rof1 [Arabidopsis thaliana]
Comment: peptidylprolyl isomerase
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39784)
Chromosome
6
Position
95.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1789 was used as an overgo probe on plate 2 [well H10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGCTGCTAGATGGCACAGTCTTC
B sequence
CATGGCCCTTCTTTGTGAAGACTG
AB sequence
AAGCTGCTAGATGGCACAGTCTTCACAAAG
Marker sequence
GATGGAGTGGAGTTCACTGTTCAAGATGGTCATTTTTGTCCTGCTCTTGC
TAAAGCTGTGAAAACTATGAAGAAAGGTGAAAAGGTCCAATTGACAGTGA
AGCCACAATATGGCTTCGGAGAGAAAGGAAAACCAGCCTCGAGTGATGGA
GGAGCAGTTCCTCCTAATGCCACATTACAGATCAACTTGGAGTTGGTCTC
CTGGAAAACTGTTTCAAATGTTACTGATGACAAGAAAGTAGTAAAGAAGA
TCTTGATAGAAGGGGAAGGATATGAGAGACCCAATGAAGGAGCTGTTGTT
AAATTAAAACTGGTTGGCAAGCTGCTAGATGGCACAGTCTTCACAAAGAA
GGGCCATGATGGGGAAAGTGAAGATAATCTTTTTGAGTTTAAGACAGATG
ACGAACAAGTAATTGATGGGCTGGACAGAGCTGTCATGACAATGAAGAAA
GGTGAAGCGGCGCTGCTTACAATTGCACCTGAATATGCCTTTGGTTCATC
TGAGTCGAAGCAAGATTCAGCTGTTGTTCCTCCTAATTCAACTGTGCATT
ATGAGGTTGAGCTTGTTTCTTTT
Genomic location of T1789  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2274 marker 2274
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)