SGN Marker solcap_snp_sl_37626

SGN-M22743

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72544)
Chromosome
5
Position
80.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68642)
Chromosome
5
Position
83.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65025)
Chromosome
5
Position
133.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59074)
Chromosome
5
Position
63.55 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGGTGAGGATCTTCATCAAATGGTCAGTCAGGTCACGACCTGCCAAGTC
  
3' flanking region
AGACGAAGAATGGCATGTGGGAGGGCATATCCCTCGTAAATTGGGACAGT
SNP nucleotide
AG
SNPdb format
TCGGTGAGGATCTTCATCAAATGGTCAGTCAGGTCACGACCTGCCAAGTC[A/G]
AGACGAAGAATGGCATGTGGGAGGGCATATCCCTCGTAAATTGGGACAGT
  
Genomic location of solcap_snp_sl_37626  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22743 marker 22743
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)