SGN Marker solcap_snp_sl_37689

SGN-M22749

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72549)
Chromosome
5
Position
83.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68646)
Chromosome
5
Position
86.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65029)
Chromosome
5
Position
134.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59080)
Chromosome
5
Position
63.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAATGACCTTTCACACCCTCAATATTGCTTCAAGGTCGATGTCAATGCAC
  
3' flanking region
GGAGAATCACATGACCGGGTGTGCGGTTATCTTGGGAGATATAAATGTGG
SNP nucleotide
AG
SNPdb format
CAATGACCTTTCACACCCTCAATATTGCTTCAAGGTCGATGTCAATGCAC[A/G]
GGAGAATCACATGACCGGGTGTGCGGTTATCTTGGGAGATATAAATGTGG
  
Genomic location of solcap_snp_sl_37689  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22749 marker 22749
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)