SGN Marker solcap_snp_sl_37787

SGN-M22756

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68650)
Chromosome
5
Position
89.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65032)
Chromosome
5
Position
143.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59087)
Chromosome
5
Position
64.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATTTGCAAAATCATGCAAACAAATTCCAGGAAGTTGATATTCCCTCCAC
  
3' flanking region
AATGGAGTTACAGACAATGTTCCATCCAATCCCCATATCAGTACAAGCTG
SNP nucleotide
AG
SNPdb format
AATTTGCAAAATCATGCAAACAAATTCCAGGAAGTTGATATTCCCTCCAC[A/G]
AATGGAGTTACAGACAATGTTCCATCCAATCCCCATATCAGTACAAGCTG
  
Genomic location of solcap_snp_sl_37787  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22756 marker 22756
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)