SGN Marker solcap_snp_sl_37808

SGN-M22759

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72556)
Chromosome
5
Position
86.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59090)
Chromosome
5
Position
64.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAAACAATTGTTCTGAAACCACCTTCAAATGGGATTTTTATGTCTGAAT
  
3' flanking region
ATTTTGCATCTCACATCAGCAACAAGATGGCGAATATGAGGCGCGTACCA
SNP nucleotide
CG
SNPdb format
GGAAACAATTGTTCTGAAACCACCTTCAAATGGGATTTTTATGTCTGAAT[C/G]
ATTTTGCATCTCACATCAGCAACAAGATGGCGAATATGAGGCGCGTACCA
  
Genomic location of solcap_snp_sl_37808  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22759 marker 22759
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)