SGN Marker solcap_snp_sl_37888

SGN-M22766

Synonyms  
SGN-U580266_snp391
SGN-U580266_snp391_solcap_snp_sl_37888
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70454)
Chromosome
5
Position
88.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66984)
Chromosome
5
Position
93.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63460)
Chromosome
5
Position
149.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59097)
Chromosome
5
Position
64.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATTGTTGTCCACAGTATTGTCTTCATAAAACCAATGTGCGCACTCCAC
  
3' flanking region
AGAAACAAAATCCTCTCAAATGATTGCTGATCTTCTTTTGGCACGTTCAA
SNP nucleotide
AG
SNPdb format
GGATTGTTGTCCACAGTATTGTCTTCATAAAACCAATGTGCGCACTCCAC[A/G]
AGAAACAAAATCCTCTCAAATGATTGCTGATCTTCTTTTGGCACGTTCAA
  
Genomic location of solcap_snp_sl_37888  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22766 marker 22766
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)