Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_38

SGN-M22771

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72566)
Chromosome
5
Position
51.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68658)
Chromosome
5
Position
60.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65040)
Chromosome
5
Position
70.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59102)
Chromosome
5
Position
60.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGTTTCAAAAGTCAGCAATGAGATGGCTCTAGCCCTCTCTGCGGACAAA
  
3' flanking region
TAAAGCTTACCCATGACGTGAAGGATTGCGACAAAACCTATAAAGCCAAT
SNP nucleotide
CG
SNPdb format
AAGTTTCAAAAGTCAGCAATGAGATGGCTCTAGCCCTCTCTGCGGACAAA[C/G]
TAAAGCTTACCCATGACGTGAAGGATTGCGACAAAACCTATAAAGCCAAT
  
Genomic location of solcap_snp_sl_38  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22771 marker 22771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)