SGN Marker TG424

SGN-M228

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1550
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAGGGGATGTGGAAATCGTGTTATTCAGCGAGGCATAGCAGTGCCATTGCAGGTAAGAAAAATATTGCAAACCAAGAGTTTCATGTACCA
TAACTTTGCCTCTTTATGAACATAAAAAATAGGAGATTGTTTCAGTACTAGTGAGAATGATGTTAGGAGTAGTCATTTAAATTATTGGTC
TGAGAAAACATGATGCTCCCTCTGTCCCAATTTATTTGGCACCTTTGACTTGACATAAAATTTAAGAAATAACGGGAGACTTTTGAAATG
TGGTCTAAAACACACCTTAGGCCCTTGTATGACATAAAAGGGGAATTTTAAAGTCAAGTTATTTCTAATTATATGGATGTGGCATTTTTT
TTTGGGACATACTAAAAGGGAAAGTGTGCCACAAATTGGGACAGAGGGAGTAATCTTTTGTGGTTGAACTATAATATATATTGTTTTTTC
Reverse sequence
TGACATTAAAAAAAAATGCTTGCTGTAGTTATTGCACGGGTTTCTAAGTAACAGAGAGATACTTCAAAAAGCGTTAAGAGAAAGATAGAT
AACAAGTACATGGTAGTAGTGATGATCTGGAGTCTCTACTTCAACTGGGATCTCAATCAAGTTACCTTCATAACATCTGGTCAAGATAAA
ATTACAATGTGGTAAGTTTCAGTCCACATTGCGAAGTAAAAAAGAATCAATGCACTTTTCTTGAATGTAAATGTGATTCTTAGAAACAAT
AAAAGCAAAGAATGAGCTGTTGATCATGCAAAGAAGAAAAAAGGGACTTCTAATGGTGCTCAATTGGGGGTTTATTCCATGCCAAATGTA
CATCAAAAAGAAAGCCATAACAAAAGGAATCAATATGATTATTATATCTCTACATGCAATATATAGGGTTGCATCTAATTTTTACCTATC
AGTTTTCTTTCCAAAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1685412e-0646 (10.2% of RFLP seq)+
SGN-U1510775.3e-0735 (7.5% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53312)
Chromosome
9
Position
85.21 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50387)
Chromosome
9
Position
65.43 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48321)
Chromosome
9
Position
83.70 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42460)
Chromosome
9
Position
94.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40870)
Chromosome
9
Position
93.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36581
Forward primer (5'-3')
GAGTTGCTTATCGCTTTAGCC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTTTATGTCAAGTCAAAGGTGTCA
Digested band sizes (using Tsp45I)
Solanum lycopersicum TA209
280
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40040)
Chromosome
9
Position
86.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8681)
Chromosome
9
Position
103.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8680)
Chromosome
9
Position
92.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG424 was used as an overgo probe on plate 14 [well G8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTGTTATTCAGCGAGGCATAGCAG
B sequence
CTTACCTGCAATGGCACTGCTATG
AB sequence
GTGTTATTCAGCGAGGCATAGCAGTGCCAT
Marker sequence
CAGGGGATGTGGAAATCGTGTTATTCAGCGAGGCATAGCAGTGCCATTGC
AGGTAAGAAAAATATTGCAAACCAAGAGTTTCATGTACCATAACTTTGCC
TCTTTATGAACATAAAAAATAGGAGATTGTTTCAGTACTAGTGAGAATGA
TGTTAGGAGTAGTCATTTAAATTATTGGTCTGAGAAAACATGATGCTCCC
TCTGTCCCAATTTATTTGGCACCTTTGACTTGACATAAAATTTAAGAAAT
AACGGGAGACTTTTGAAATGTGGTCTAAAACACACCTTAGGCCCTTGTAT
GACATAAAAGGGGAATTTTAAAGTCAAGTTATTTCTAATTATATGGATGT
GGCATTTTTTTTTGGGACATACTAAAAGGGAAAGTGTGCCACAAATTGGG
ACAGAGGGAGTAATCTTTTGTGGTTGAACTATAATATATATTGTTTTTTC
Genomic location of TG424  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D228 marker 228
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)