Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_38495

SGN-M22812

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72595)
Chromosome
12
Position
40.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68681)
Chromosome
12
Position
52.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65062)
Chromosome
12
Position
62.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59143)
Chromosome
12
Position
44.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAACACGTTTTGTCAGAAAGAAATACCTCAGCTTAGGCAGATCGTCAAGA
  
3' flanking region
GCAGTTCTTCCAACAGTGGAAATAAGGTCATTATTTCTTCTCCTTGTTGT
SNP nucleotide
TC
SNPdb format
TAACACGTTTTGTCAGAAAGAAATACCTCAGCTTAGGCAGATCGTCAAGA[T/C]
GCAGTTCTTCCAACAGTGGAAATAAGGTCATTATTTCTTCTCCTTGTTGT
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_38495  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22812 marker 22812
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)