SGN Marker solcap_snp_sl_38698

SGN-M22839

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68692)
Chromosome
7
Position
26.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65074)
Chromosome
7
Position
30.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59170)
Chromosome
7
Position
7.63 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAGTAATTACAGACGTTGTAGTAGCTCTTGACGGAACTGGTAATTTTAC
  
3' flanking region
CGAATTAAAGATGCAATAGACGCAGCACCACAATTGAGTACAAAAAGATT
SNP nucleotide
AC
SNPdb format
GGAGTAATTACAGACGTTGTAGTAGCTCTTGACGGAACTGGTAATTTTAC[A/C]
CGAATTAAAGATGCAATAGACGCAGCACCACAATTGAGTACAAAAAGATT
  
Genomic location of solcap_snp_sl_38698  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22839 marker 22839
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)