SGN Marker solcap_snp_sl_38945

SGN-M22879

Synonyms  
SGN-U577304_snp134
SGN-U577304_snp134_solcap_snp_sl_38945
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70435)
Chromosome
7
Position
35.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66961)
Chromosome
7
Position
32.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63438)
Chromosome
7
Position
44.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59210)
Chromosome
7
Position
54.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTCCTATGGTCTACCGGTCTACTATCTCGGCTTAGCCGCCTCTAACCGT
  
3' flanking region
AAGCTAGGCAACACTCGACTACCTTAAATCCTTGTGACATAGAGAAAATC
SNP nucleotide
CG
SNPdb format
CCTCCTATGGTCTACCGGTCTACTATCTCGGCTTAGCCGCCTCTAACCGT[C/G]
AAGCTAGGCAACACTCGACTACCTTAAATCCTTGTGACATAGAGAAAATC
  
Genomic location of solcap_snp_sl_38945  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22879 marker 22879
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)