SGN Marker solcap_snp_sl_39

SGN-M22887

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72637)
Chromosome
5
Position
52.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68710)
Chromosome
5
Position
60.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65092)
Chromosome
5
Position
72.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59218)
Chromosome
5
Position
60.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCCGTGTTGAATCGGATCAACTCATTGATCACAAAATCGTTAGCGAACT
  
3' flanking region
ATTCAAAAACTTCAATACTTCTTCGTGCCCAGGAAAGTTCAATTGATTCC
SNP nucleotide
TC
SNPdb format
CTCCGTGTTGAATCGGATCAACTCATTGATCACAAAATCGTTAGCGAACT[T/C]
ATTCAAAAACTTCAATACTTCTTCGTGCCCAGGAAAGTTCAATTGATTCC
  
Genomic location of solcap_snp_sl_39  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22887 marker 22887
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)