SGN Marker solcap_snp_sl_39082

SGN-M22896

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68715)
Chromosome
6
Position
38.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59227)
Chromosome
6
Position
38.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCCATGCTTCCCTACTGGTTCTCTGCCATGACCATGAAGAGTGTCGGTA
  
3' flanking region
TGCAGCTCTGAAGATGGTTGAGGAAGTTCGCCGACAATTTAACACCATCC
SNP nucleotide
AG
SNPdb format
TGCCATGCTTCCCTACTGGTTCTCTGCCATGACCATGAAGAGTGTCGGTA[A/G]
TGCAGCTCTGAAGATGGTTGAGGAAGTTCGCCGACAATTTAACACCATCC
  
Genomic location of solcap_snp_sl_39082  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22896 marker 22896
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)