Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_39407

SGN-M22923

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72657)
Chromosome
9
Position
13.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68725)
Chromosome
9
Position
43.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65106)
Chromosome
9
Position
57.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59254)
Chromosome
9
Position
5.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCCATCAGCTTACTCCGGTAAAATAATAGAGTGCTCTTTTGACACTGAT
  
3' flanking region
ACCAAAAATGGATATGGATGAGGACCAGAGTCGACAAAGGAACTCCGAAT
SNP nucleotide
AG
SNPdb format
ATCCATCAGCTTACTCCGGTAAAATAATAGAGTGCTCTTTTGACACTGAT[A/G]
ACCAAAAATGGATATGGATGAGGACCAGAGTCGACAAAGGAACTCCGAAT
  
Genomic location of solcap_snp_sl_39407  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22923 marker 22923
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)