SGN Marker solcap_snp_sl_39470

SGN-M22930

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72662)
Chromosome
9
Position
11.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68729)
Chromosome
9
Position
41.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65110)
Chromosome
9
Position
56.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59261)
Chromosome
9
Position
4.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAATGACAATTGACTCACATATGGGCTTGCCATTATGAATTAGCACAGG
  
3' flanking region
ACTTTCTTGTAAATTGGATTGGATTCAAGAAGTATTGGACTCTTATTTTG
SNP nucleotide
AT
SNPdb format
AGAATGACAATTGACTCACATATGGGCTTGCCATTATGAATTAGCACAGG[A/T]
ACTTTCTTGTAAATTGGATTGGATTCAAGAAGTATTGGACTCTTATTTTG
  
Genomic location of solcap_snp_sl_39470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22930 marker 22930
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)