Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker solcap_snp_sl_39516

SGN-M22938

Synonyms  
SGN-U329408_snp291
SGN-U329408_snp291_solcap_snp_sl_39516
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70366)
Chromosome
9
Position
6.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66900)
Chromosome
9
Position
40.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63384)
Chromosome
9
Position
51.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59269)
Chromosome
9
Position
4.56 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGAAGGGTTCAACAAGTAGATTCCAGCATTGATCTTGTTACCCACGAAC
  
3' flanking region
CCTTTGGTTTTTCTACAAACTTTTCAACTCTCCCAGTCGCTTCTTCCATG
SNP nucleotide
AG
SNPdb format
CAGAAGGGTTCAACAAGTAGATTCCAGCATTGATCTTGTTACCCACGAAC[A/G]
CCTTTGGTTTTTCTACAAACTTTTCAACTCTCCCAGTCGCTTCTTCCATG
  
Genomic location of solcap_snp_sl_39516  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22938 marker 22938
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)