SGN Marker TG366

SGN-M23

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ACTATAATAAATACTAATGCTTAATTTATGCAATGCTACAAAGAGAAGGAGCACATCTAATGAAGCTATCTCTGAGATATGCAATAATCA
TAAGTTATAGCAGGAACACTGAGTATTACTGTTCCCAAATGGTTAACGGGATCAACAGATAATTGCTGAGAGATAAGAATGCGTTGAGAC
AAAGCAGGAACCCTCACCAAAAAATGGAACCGCAAGACCAACTACTACTGTGGAGATTGTCAATGCAGTTCTAATGAGGATTGGGTACAG
GTGAGATTTGGTGTGTTTTGACGGCAACAATTCCTCCAGACTCATTGCTACTGGAGACAGGGTTAAAGCAAATGTACATCTGATTAAGGA
AGACATTTTTTTTTCAAGAGATATCACCTTAGAAAATTGCATATATGAAATGAGACTGAATACAAAGAAGAGAATCTTTTGACAGAAGTG
CCTTAAATTAAAGCTGATGACTTTTGCAGCAGCCAGCATGAAGTTATCCAGGTTTTCATATCTGTTCATTCTTTATATAGCAGCACCAGA
AAAAAGTAGGATTCATGTCTTTCTAAGTATCATATTTCA
Reverse sequence
TCCTCTTGACCAGGTATTTGTTCGTAGATGCTCATGACTTGCTTGTTGAAGTCTGTTGATTAAATCGGAGATATGCTCTAGGATAGGAAT
ACATGTTCCAGCTCTCTCTAGCAATCCATGCAAGGAAAAAATAAAAAAAACTGGAACCTTACCCCATCATTCAGTAATATCAGTACCAAG
GTTGAATTCTGGTGTAGATTATCAATGCCAACTTAACCAGATTATTCTGAAAATGATCCTGCGTTCCCAGGGTTTGTTTTGATGTTCAGT
TTTTTCCTTATTTTGCGAACTCTGGGTTTAATTTGGATGCAGTTTTGGTTTGGTGACTCTGTTGTATGGTGGAACTGCTGTGTTGGGATA
CCTGATGTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 7779)
Chromosome
3
Position
54.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG366 was used as an overgo probe on plate 4 [well G7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P176F19,   P254P03,   P134A09,   P075K10,   P332K22

 Overgo Sequences

A sequence
TGACGGCAACAATTCCTCCAGACT
B sequence
GTCTCCAGTAGCAATGAGTCTGGA
AB sequence
TGACGGCAACAATTCCTCCAGACTCATTGC
Marker sequence
ACTATAATAAATACTAATGCTTAATTTATGCAATGCTACAAAGAGAAGGA
GCACATCTAATGAAGCTATCTCTGAGATATGCAATAATCATAAGTTATAG
CAGGAACACTGAGTATTACTGTTCCCAAATGGTTAACGGGATCAACAGAT
AATTGCTGAGAGATAAGAATGCGTTGAGACAAAGCAGGAACCCTCACCAA
AAAATGGAACCGCAAGACCAACTACTACTGTGGAGATTGTCAATGCAGTT
CTAATGAGGATTGGGTACAGGTGAGATTTGGTGTGTTTTGACGGCAACAA
TTCCTCCAGACTCATTGCTACTGGAGACAGGGTTAAAGCAAATGTACATC
TGATTAAGGAAGACATTTTTTTTTCAAGAGATATCACCTTAGAAAATTGC
ATATATGAAATGAGACTGAATACAAAGAAGAGAATCTTTTGACAGAAGTG
CCTTAAATTAAAGCTGATGACTTTTGCAGCAGCCAGCATGAAGTTATCCA
GGTTTTCATATCTGTTCATTCTTTATATAGCAGCACCAGAAAAAAGTAGG
ATTCATGTCTTTCTAAGTATCATATTTCA
Genomic location of TG366  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23 marker 23
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)