SGN Marker CT259

SGN-M230

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTGGAAAAAAAAATTGTTGAAGATTAATTTGACATGGTAGCAAAGATGTTTACAAATACAAAACATCCAGAGGAAATTCTTC
GAACAGGCACAATCTTAGAAAAACAATAAAATTATACACTGGCAAAGATAACACTAGAAGTATGGATAAGATCCTCAAAGTACAGATGTC
TTGAATCACACTCTGTGACATCCAAAGTTTCAATTGTACATGACCAAACATCTATGCCAGTTCACAGAAATGCATCCTTCTCAAGCAGCT
TTAGGACATCCTGCTGGTTGTTGAGTTTGGCAACATCAATTGGCGTCTTTCCGTCCAAGTTTTGAAGAGTTACAGCGGCTCCATTCTCCA
GCAGCAGTGCTACACACTCCTTTCTACCATATCCAGCAGCATAGTGAAGAGCAGTATTCTTGTTCTTGTCCAATGCATCAACCTTTGCCC
CAGCTTCAACAAGGAGCTGAGCACACTTCTCCTCGCCATATCCA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U143687473 (95.7% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51891)
Chromosome
7
Position
35.93 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42965)
Chromosome
1
Position
47.70 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43965
Forward primer (5'-3')
TTACAAATACAAAACATCCAGAGG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ACTGCTCTTCACTATGCTGCTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8685)
Chromosome
4
Position
44.70 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT259 was used as an overgo probe on plate 9 [well D12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GCATCCTTCTCAAGCAGCTTTAGG
B sequence
ACAACCAGCAGGATGTCCTAAAGC
AB sequence
GCATCCTTCTCAAGCAGCTTTAGGACATCC
Marker sequence
CTTTTTTTTTGGAAAAAAAAATTGTTGAAGATTAATTTGACATGGTAGCA
AAGATGTTTACAAATACAAAACATCCAGAGGAAATTCTTCGAACAGGCAC
AATCTTAGAAAAACAATAAAATTATACACTGGCAAAGATAACACTAGAAG
TATGGATAAGATCCTCAAAGTACAGATGTCTTGAATCACACTCTGTGACA
TCCAAAGTTTCAATTGTACATGACCAAACATCTATGCCAGTTCACAGAAA
TGCATCCTTCTCAAGCAGCTTTAGGACATCCTGCTGGTTGTTGAGTTTGG
CAACATCAATTGGCGTCTTTCCGTCCAAGTTTTGAAGAGTTACAGCGGCT
CCATTCTCCAGCAGCAGTGCTACACACTCCTTTCTACCATATCCAGCAGC
ATAGTGAAGAGCAGTATTCTTGTTCTTGTCCAATGCATCAACCTTTGCCC
CAGCTTCAACAAGGAGCTGAGCACACTTCTCCTCGCCATATCCA
Genomic location of CT259  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D230 marker 230
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)