SGN Marker solcap_snp_sl_40154

SGN-M23023

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72713)
Chromosome
1
Position
102.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68770)
Chromosome
1
Position
92.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65149)
Chromosome
1
Position
157.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59354)
Chromosome
1
Position
83.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGCGCCTAGAACTGCTTCTTCTTTTCTTGTGACGCGAACTTCTGTCTCTT
  
3' flanking region
TCTCATCCAACCACTCACTGCTGGAATCTGTATTACGATCTTCCTTGCTA
SNP nucleotide
TG
SNPdb format
GGCGCCTAGAACTGCTTCTTCTTTTCTTGTGACGCGAACTTCTGTCTCTT[T/G]
TCTCATCCAACCACTCACTGCTGGAATCTGTATTACGATCTTCCTTGCTA
  
Genomic location of solcap_snp_sl_40154  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23023 marker 23023
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)