SGN Marker solcap_snp_sl_40303

SGN-M23041

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72723)
Chromosome
1
Position
104.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68778)
Chromosome
1
Position
94.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65153)
Chromosome
1
Position
162.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59372)
Chromosome
1
Position
84.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCACACAACAACCATATTGCTGCCCTCGCCATAGCATTGAAACAAGTGGC
  
3' flanking region
ACTCCTGATTACAGGGCTTATATGCAACAAGTTAAGAGAAATGCTCAGGC
SNP nucleotide
AG
SNPdb format
CCACACAACAACCATATTGCTGCCCTCGCCATAGCATTGAAACAAGTGGC[A/G]
ACTCCTGATTACAGGGCTTATATGCAACAAGTTAAGAGAAATGCTCAGGC
  
Genomic location of solcap_snp_sl_40303  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23041 marker 23041
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)